There were 482 press releases posted in the last 24 hours and 468,808 in the last 365 days.

DCAF14 regulates CDT2 to promote SET8-dependent replication fork protection

Fiber analysis by DNA spreading

DNA fiber labeling analysis was performed as described previously (Jackson & Pombo, 1998). To measure fork speeds in unchallenged conditions, cells were pulsed sequentially with 20 μM CldU and 100 μM IdU for 30 min each. To analyze fork elongation in the presence of CPT, cells were pulsed with CldU for 30 min, followed by IdU for 30 min in the presence of 100 nM CPT. MG132 was added concomitantly with CPT for 30 min where indicated. For nascent strand degradation assays, cells were sequentially pulsed with CldU and IdU for 30 min each followed by release into 4 mM HU for 4 h. MG132, p97i, MLN4924, UNC0379, MRE11i (Mirin), and DNA2i (C5) treatments in NSD analyses were performed in the presence of HU for 4 h. To assess fork recovery after release from replication stress, cells were pulsed with CldU for 30 min, released into 4 mM HU for 4 h, and pulsed with IdU for 60 min. After treatments and labeling schemes, cells were harvested, lysed on slides and DNA was stretched by tilting the slides. DNA was then fixed using 3:1 solution of methanol:acetic acid and stored at −20°C overnight. Next day, DNA was denatured using 2.5 N HCl for 45 min, blocked in PBS containing 0.1% Triton X-100 and 10% goat serum for 1 h, stained with primary antibodies for 2 h to recognize IdU and CldU followed by staining with secondary antibodies for 1 h. Images were acquired using a 60X oil objective (1.4 NA) on Keyence BZ-X710 and fiber lengths were analyzed using ImageJ.

Antibodies

Antibodies used for Western blotting (WB) and immunofluorescence (IF) were used as described: DCAF14 (1:500, WB, NBP2-33883; Novus), CDT2 (1:500, WB, ABS500; Millipore), CDT1 (1:500, WB, 8064S; CST), SET8 (1:500, WB, 06-1304; Millipore and 1:200, IF, 2996T; CST), P21 (1:500, WB and 1:200, IF, sc-6246; SantaCruz), PHF8 (1:2,000, WB, A301-772A; Bethyl Laboratories), PCNA Rb (1:2,000, WB and 1:200, IF, ab18197; Abcam), PCNA Ms (1:200, IF, sc-56; SantaCruz), CUL4A (1:250, WB, ab72548; Abcam), MRE11 (1:500, WB, 4895S; CST), DNA2 (1:500, WB, PA5-77943; Invitrogen), SMARCAL1 (1:500, WB, sc-376377; SantaCruz), ZRANB3 (1:500, WB, A303-033A; Bethyl Laboratories), BrdU-Rat (1:10, IF, ab6326; Abcam), BrdU-Ms (1:100, IF, 347580; BD Biosciences), Biotin Rb (1:200, IF, A150-109A; Bethyl Laboratories), Biotin Ms (1:200, IF, 200-002-211; Jackson ImmunoResearch), KU70 (1:2,000, WB, ab92450; Abcam), H3 (1:6,000, WB, ab6326; Abcam), H4 (1:4,000, WB, ab177840; Abcam), H4K20me1 (1:1 k, WB and 1:200, IF, 39729; Active Motif), H4K20me3 (1:1,000, WB, sc-134216; SantaCruz), H3K4me3 (1: 1,000, WB, ab8580; Abcam), H3K9me1 (1:1,000, WB, ab176880; Abcam), H3K9me3 (1:1,000, WB, ab8898; Abcam), H3K27me3 (1:1,000, WB, ab6002; Abcam), H3K36me3 (1:1,000, WB, ab9050; Abcam), WDR5 (1:500, WB, sc-393080; SantaCruz), RBBP5 (1:500, WB, sc-271072; SantaCruz), BRCA2 (1:500, WB, OP95; Millipore Sigma), HA (1:1,000, WB, H3663; Sigma-Aldrich), donkey anti-rabbit 800CW (1:20,000, WB, 926-32213; LI-COR), donkey anti-mouse 800CW (1:20,000, WB, 926-32212; LI-COR), Alexa Fluor 594 goat anti-rabbit IgG (1:2,000, IF, A11037; Invitrogen), Alexa Fluor 594 goat anti-mouse IgG (1:2,000, IF, A11005; Invitrogen), Alexa Fluor 594 goat anti-rat IgG (1:2,000, IF, A11007; Invitrogen), Alexa Fluor 488 goat anti-mouse IgG (1:2,000, IF, A11029; Invitrogen). For DNA combing assay, the following antibodies were used: BrdU-Rat (1:305, IF, ab6326; Abcam), BrdU-Ms (1:6.25, IF, 347580; BD Biosciences), Ms anti-ssDNA (1:12.5, IF, AutoAnti-S; DSHB), goat anti-rat Cy5 (1:12.5, IF, ab6565; Abcam), goat anti-Ms Cy3 (1:12.5, IF, ab97035; Abcam), goat anti-Ms BV490 (1:12.5, IF, 115-685-166; Jackson).

siRNAs and plasmids

ON-TARGETplus or custom siRNAs were obtained from Dharmacon except where indicated: DCAF14 (J-019291-06), CDT2 (L-020543-00-0005), CDT2#2 (GCUGAGCUUUGGUCCACUA), CDT1 (L-003248-00-0005), CDT1#2 (AACGUGGAUGAAGUACCCGACUU), SET8 (13067S, CST), SET8 (3′UTR) (Custom siRNA, Sense sequence: GAACAGAUGGCCUUAUAUU, [Tanaka et al, 2017]), p21 (L-003471-00-0005), p21#2 (AACAUACUGGCCUGGACUG), DCAF14 (5′UTR) (pool of J-019291-07 and J-019291-08), MRE11 (J-009271-08), DNA2 (pool of D-026431-03 and D-026431-04, siGENOME Dharmacon), SMARCAL1 (J-013058-06), ZRANB3 (D-010025-03, siGENOME Dharmacon), WDR5 (L-013383-00-0005), RBBP5 (L-012008-00-0005), All-stars negative control siRNA (1027280; QIAGEN). Plasmids were obtained from Origene: DCAF14 cDNA clone (RC217114) and entry vector (PS100001). HA-tagged WT ubiquitin plasmid was obtained from Addgene (#17608; Plasmid).

Legal Disclaimer:

EIN Presswire provides this news content "as is" without warranty of any kind. We do not accept any responsibility or liability for the accuracy, content, images, videos, licenses, completeness, legality, or reliability of the information contained in this article. If you have any complaints or copyright issues related to this article, kindly contact the author above.