There were 1,637 press releases posted in the last 24 hours and 459,554 in the last 365 days.

arfA antisense RNA regulates MscL excretory activity

Introduction

Bacteria are subject to numerous and occasionally drastic intracellular challenges and extracellular perturbations to which they respond by triggering their defence mechanisms through the expression of stress-responsive genes (1, 2). These mechanisms are necessary for repairing damage, returning cellular homeostasis, and increasing cell survival. One of the common stress conditions that microorganisms encounter is translational stress which can be caused by antibiotics targeting the ribosome and chemical/physical damage of mRNA, resulting in ribosome stalling on nonstop mRNA (3, 4). Furthermore, because of transcription–translation coupling and rapid transcript turnover in bacteria, incomplete transcripts (both nascent and decay intermediates) are known to be ubiquitous, requiring efficient mechanisms to resolve stalled ribosomes (5). Recently, it has also been shown that ribosome collisions lead to recruitment of the endonuclease SmrB that cleaves mRNA and triggers ribosome rescue (6). Bacteria have developed a number of response mechanisms to deal with this translational stress, the primary ribosome rescue system (trans-translation) consisting of the ssrA (tmRNA) and SmpB complex mediates the release of the stalled ribosome, targets the truncated peptide for degradation, and promotes mRNA turnover (3, 7, 8). Previous studies have shown that when trans-translation is impaired or overloaded, alternative tmRNA–independent ribosome rescue system(s) prevent translational collapse (9). One such system, the alternative ribosome–rescue factor A (ArfA), is up-regulated when the trans-translation system is overloaded. Indeed, arfA mRNA undergoes RNaseIII processing to generate a mature transcript lacking a stop codon which in turn is recognised and degraded by the tmRNA and SmpB complex (10, 11). When the trans-translation system is impaired or overloaded, arfA transcript escapes tmRNA-mediated degradation allowing active ArfA protein to be produced to provide a backup system for ribosome rescue (7, 11). How the ArfA protein is released from the stalled ribosome, when tmRNA system is compromised, is currently unknown.

Another stress condition that bacteria commonly face is osmotic stress in response to sudden changes in external osmolarity. To counteract the impact of rapid cell volume expansion upon hyposmotic shock, bacteria use a group of inner membrane proteins known as mechanosensitive (MS) channels (12, 13). In Escherichia coli, the two major MS channels are the small-conductance (MscS) and large-conductance (MscL) mechanosensitive channels (14, 15). MscL has a larger channel pore (∼30 Å) than MscS (∼14 Å) in the open state and requires greater pressure for gating (MscL 10 mN/m, MscS 5 mN/m) (14, 16). Because of the relatively large channel pore size, MscL jettisons not only water and solutes but also cytoplasmic proteins during its gating (17, 18, 19). Interestingly, in E. coli, mscL and arfA are genomically co-located and arranged in a convergent tail-to-tail orientation and share an extended complementary region between the 3′ UTR of mscL (20) and 3′ CDS of arfA. Furthermore, MscL has been identified as a potential antibacterial drug target and has also been implicated in the cellular uptake of the ribosome-targeting antibiotic streptomycin (21, 22). Gentamycin, another aminoglycoside from this class, and also chloramphenicol have been shown to up-regulate arfA transcript levels (23).

We previously discovered that E. coli cells encountering both hypoosmotic stress and arfA-mediated response to translational stress undergo a proteome mis-localisation phenomenon, via the MscL channel (17), which we termed excretion of cytoplasmic proteins (ECP). ECP, also referred to as nonclassical secretion or protein moonlighting, has important implications for how bacterial cells interact with their external environment. Indeed, some of these excreted proteins have been reported to mediate host–pathogen interactions (24), biofilm formation (23), suppress macrophage activation (25), and are linked to survival and pathogenicity (26). Yet, the mechanisms of ECP are poorly understood (27), and it was previously unknown how mscL and arfA collectively mediate ECP in response to stress.

Here, using a combination of gene content and intergenic distance analysis, promoter–reporter assays, quantitative real time PCR (qRT-PCR), targeted gene deletion, and phenotypic analysis under different stress conditions, we sought to explore the degree of genomic conservation of arfA and mscL across bacteria, and their regulation in the presence of various stress-related factors. Furthermore, we investigated the antisense RNA (asRNA)–mediated mechanism by which arfA regulates the excretion activity of MscL in E. coli.

Results

mscL and arfA co-localisation is enriched in gammaproteobacteria

Because of the important roles that mscL and arfA display in responding to osmotic and translational cell stress both individually (3, 28) and collectively (17) and their genomic co-localisation in E. coli, we sought to explore the degree to which their presence is conserved across bacterial and archaeal kingdoms. Hidden Markov models (HMMs) of the MscL and ArfA proteins were obtained from the Pfam database (29), and these were used to query NCBI prokaryote representative and reference complete proteomes. A cladogram was constructed using NCBI taxonomic information (Fig 1A). The presence of MscL-coding sequence is shown to be predominately conserved across the bacteria kingdom present in 72% (2,575/3,594) of the genomes queried and was identified in a small subset of archaea genomes (10%, 22/228). In contrast, ArfA-coding sequence is shown to be present in a smaller number of bacterial genomes (10%, N = 375), within these 75% also contain mscL (N = 282). Taxonomic analysis of the resultant clustered genomes indicates that the cluster containing only mscL (mscL-only) is composed of species from across a wide range of phyla present in the dataset (Fig S1). Notably, actinobacteria, bacteroidetes, and firmicutes are highly enriched with mscL-only species comprising 93%, 92%, and 77% of the entire phylum, respectively (Table S1). In contrast, the arfA-only cluster is almost exclusively composed of Gammaproteobacteria (95%), and the exception to this is a small subset of Betaproteobacteria, including clinically important N. meningitidis and N. gonorrhoeae, indicating probable horizontal gene transfer (Fig S1). The mscL–arfA cluster is almost entirely restricted to Gammaproteobacteria (94%), enriched with species belonging to the Enterobacterales (49%) and Pseudomonadales (28%) orders (Fig 1A). A small number of Betaproteobacteria exceptions were identified within the mscL–arfA cluster (N = 14), including a number of Neisseria species. In contrast to the mscL-only cluster, which is much more taxonomically diverse, the mscL–arfA cluster displays narrower taxa indicative of an earlier ancestry of the mscL gene and suggesting that arfA was acquired later after the proteobacteria division.

Figure 1. Taxonomic analysis of mscL and arfA prokaryotic organisms.

(A) Cladogram of prokaryotic organisms obtained from NCBI representative and reference complete genome/proteome dataset, branches are coloured according to phyla/class, inner-ring indicates presence-absence of mscL and arfA genes, middle-ring indicates intergenic localisation of mscL and arfA genes and outer ring indicates taxonomic annotation. (B) Genomic co-localization and taxonomic annotation within mscL–arfA-containing organisms. The species are clustered according the mscL and arfA intergenic distance of x nucleotides: overlap (x ≤ 0), proximal (0 < x ≤ 110), and distal (x > 110). See Supplemental Data 1 for genomic and taxonomic data.

Figure S1. Taxonomic analysis of bacteria in which only arfA, mscL, or neither of them are present.

See Supplemental Data 1 for genomic and taxonomic data.

Intriguingly, the intergenic distance of mscL and arfA is not conserved, and three major sub-clusters can be assigned based on where the two genes are (i) co-located and the 3′ CDS of mscL is overlapping with the 3′ CDS of arfA (overlap), (ii) co-located but are not overlapping (proximal), and (iii) not co-located (distal) (Fig 1B). The overlap cluster (N = 25) is predominately composed of bacterial species belonging to the Enterobacteriaceae family (72%), including important clinical and model genera Salmonella and Klebsiella. The proximal cluster (N = 103) is composed of Enterobacteriaceae (38%), Pectobacteriaceae (19%), and Yersiniaceae (19%) and includes important clinical and model organisms E. coli and Citrobacter koseri. The distal cluster (N = 154) is predominately composed of Pseudomonadaceae including important clinical and model organisms Pseudomonas aeruginosa and Pseudomonas putida. As an interesting side observation, we also noticed that in some instances (N = 71) arfA is co-located with other genes instead of mscL, displaying both CDS overlap (20%) and proximal (80%) arrangements (Table S2). These observations led us to question whether the enriched co-localisation of mscL and arfA within Enterobacteriaceae genomes has a regulatory function. To probe this, we sought to explore the intergenic regulation between these genes in E. coli (Fig 2A).

Figure 2. mscL and arfA proximal gene arrangement and expression.

(A) Convergent tail-to-tail gene organisation of mscL and arfA in the genome of E. coli, including the mscL 3′ UTR (+1 to +64 nucleotides) and the complementary arfA 3′ CDS. (B) Steady-state level of mscL RNA using qRT-PCR in wt, arfA-deleted (ΔarfA), and full-length arfA restored (pFL) E. coli cells grown in minimal media with an osmolality of 215 mOsm. (C, D) sfGFP expression driven by PmscL (C) and ParfA (D) in wt and ΔrpoS strains during cell growth in minimal medium (215 mOsm) at exponential and stationary phases, respectively. The data are shown as relative RNA abundance calculated from Ct values of detected mscL normalised to the transcript level of most stable housekeeping genes (see the Materials and Methods section), and as relative fluorescence units (RFU) normalised to OD600 (RFU/OD). The error bars represent the SD of at least three biological replicates; multi-comparison ANOVA analysis was performed (P < 0.001***). ns, no significance; a.u., arbitrary units.

arfA negatively regulates mscL expression

To evaluate whether arfA regulates mscL expression, we performed transcriptional studies using qRT-PCR to monitor transcript abundance of these genes in E. coli wt and gene-specific deleted strains. Carefully designed single-gene deletions were generated to avoid polar effects (30) and direct disruption of the overlapping genes (Fig S2). Analysis of the steady-state transcript level of mscL in the arfA-deleted E. coli strain (ΔarfA) indicated an increase of >twofold in the absence of arfA (Fig 2B). Upon episomal expression of full-length arfA (pFL), the mscL transcript abundance was restored to wt levels (Fig 2B), confirming a role of arfA in the negative regulation of mscL.

Figure S2. Design of arfA- and mscL-deleted (ΔarfA) strains.

The 3′ region of arfA CDS (70 nucleotides) was maintained in ΔarfA strains, as the genomic region is a part of mscL 3′ UTR. The kanamycin selection cassette (kanR) was inserted in the opposite orientation to the target gene to avoid read-through transcription. The direction of transcription of genes is indicated by the arrows.

To explore at which level this regulation occurs, promoter–reporter plasmids (PmscL-sfGFP and ParfA-sfGFP) were created by fusing the mscL or arfA promoters (11, 15) with a reporter gene. First, promoter activity of both genes was assessed in a knockout mutant of rpoS (∆rpoS) during both exponential and stationary phases (Fig 2C and D). In agreement with previous findings (15, 31), mscL expression was associated with the activity of RpoS, as we observed a reduction in mscL promoter activity in the ∆rpoS strain relative to the wt in both exponential (1.5-fold) and stationary phases (4.0-fold) (Fig 2C). Moreover, the enhanced mscL promoter activity observed during stationary phase was dependent upon RpoS, with increasing signal only observed in the wt and not in the absence of RpoS (wt = 2.29-fold increase, ∆rpoS = 1.2-fold decrease) (Fig 2C). The results showed only a minor difference in arfA promoter activity between wt and ∆rpoS (Fig 2D). The arfA promoter activity was also similar during exponential and stationary phases in both the wt and ∆rpoS strains. Taken together, these results show that arfA promoter activity is between 4 and 10 times greater, and in contrast to the mscL promoter is neither significantly affected by growth phase nor by RpoS.

Next, promoter activity was assessed in arfA and mscL gene–deleted E. coli strains, carrying the promoter reporter plasmids, grown in minimal media with low and high osmolality (215 and 764 mOsm) (Fig 3A and B, upper panels, respectively). Consistent with the previous report (15), mscL promoter activity in wt strain was up-regulated at higher osmolality (∼3.5-fold) (Fig 3A upper panel). The pattern was similar in ΔarfA and ΔmscL strains, indicating that mscL promoter activity is independent of the presence of both genes (Fig 3A upper panel). In contrast to mscL, the arfA promoter activity showed little response to the different osmolalities across all strains (Fig 3B upper panel). These results indicate that arfA is not transcriptionally regulated in response to different external osmolalities and that its regulatory function upon mscL expression does not occur at the transcriptional level.

Figure 3. Transcriptional and post-transcriptional control of mscL and arfA expression.

(A, B) sfGFP expression driven by mscL (A upper panel) and arfA promoter (B upper panel) and steady-state transcript level of mscL (A lower panel) and arfA (B lower panel) measured in wt, arfA, and mscL-deleted (ΔarfA and ∆mscL) E. coli strains grown under different osmotic conditions in minimal media (215 and 764 mOsm). Samples were collected during exponential growth. The data are shown as relative fluorescence units (RFU) normalised to OD600 (RFU/OD) and as relative RNA abundance calculated from Ct values of detected mscL or arfA normalised to the transcript level of most stable housekeeping genes. The error bars represent the SD of at least three biological replicates; multi-comparison ANOVA analysis was performed (P < 0.01**, < 0.001***, < 0.0001****). a.u., arbitrary units.

Analysis of the mscL transcript abundance from the corresponding strains showed an increase in the higher osmolality environment (∼1.8-fold, P < 0.0092) (Fig 3A lower panel) consistent to the increase in promoter activity observed under the same conditions (Fig 3A upper panel). Although both positively regulated in response to osmolality increase, comparison of the mscL promoter (3.5-fold) and transcript (1.8-fold) changes suggest that mscL is potentially negatively regulated at the post-transcriptional level at high osmolality. In absence of arfA, mscL transcript abundance also increases independent of the external osmolality (∼2.5-fold, P < 0.0004) (Fig 3A lower panel) with no effect observed on the mscL promoter activity (Fig 3A upper panel). In contrast, analysis of the arfA transcript abundance showed no significant change in wt under different osmolalities (Fig 3B lower panel). However, in absence of mscL, the arfA transcript abundance increased only at high osmolality (2.6-fold, P < 0.0004), whereas no effect upon the arfA promoter activity was detected (Fig 3B). Collectively, these results suggest that arfA and mscL mediate down-regulation of each other at the post-transcriptional level. More specifically, the negative regulation of arfA upon mscL is observed at both high and low osmolalities, whereas the negative regulation of mscL upon arfA is only observed at high osmolality.

arfA regulates MscL-dependent excretory activity

MscL excretion activity is dependent upon arfA in E. coli cells that encounter both osmotic and translation stress conditions (17); therefore, we sought to investigate if the MscL excretion activity is regulated by arfA. First, cells were grown under high-cell density conditions, where a change in external osmolality is observed between early- and late-stage exponential growth phases, resulting in an osmolality drop of ∼70 mOsm (Fig S3A) (17). Consistent with the earlier observation (Fig 3A and B), mscL transcript levels were highest in the absence of arfA and before the drop in osmolality (Fig S3B and C). This result indicates a synergetic role of arfA and osmotic drop in mediating the reduction in mscL transcript abundance. Second, to study the impact of arfA up-regulation upon mscL, we generated a SmpB-deleted strain (ΔsmpB) in which the primary ribosome rescue system is impaired (11). arfA transcript abundance is significantly increased in the ΔsmpB strain under all conditions, whereas no change in mscL transcript abundance is observed pre-osmolality drop. The greatest reduction in mscL transcript abundance was observed in the ΔsmpB strain post-osmolality drop, providing further evidence of mscL down-regulation via a combination of arfA and osmolality. Finally, we investigated the phenotypic role (MscL production and excretion) of the arfA-mediated down-regulation of mscL in cells undergoing both growth-induced osmotic drop and arfA-mediated translational stress. To quantify MscL production, we generated wt and ΔarfA expression strains (BL21(DE3)), encoding a tagged MscL (mscL::mscLHis) and bearing an inducible (IPTG) expression plasmid (pET44-sfGFP). The His-tag modification showed no significant impact on both mscL expression and MscL excretion activity (Fig S4A and B); and the increase of arfA transcript abundance in the presence of IPTG induction confirmed that gfp overexpression results in an arfA-mediated response to translational stress as previously reported (Fig S4C) (17). Consistent with our previous finding (17), excretion of cytoplasmic GFP (%ECP) was significantly reduced (≥twofold) in absence of arfA, following the drop in media osmolality (Fig 4A upper panel). mscL transcript abundance in absence of arfA increases (≥twofold) and reflects an increase in MscL protein level (≥twofold) (Fig 4A lower panel). Here, we demonstrate that increased mscL transcript level results in increased MscL abundance but counter-intuitively with decreased MscL excretion activity in the absence of arfA. Yet, it was previously shown that clustering of MscL, which occurs with increased MscL concentration, promotes channel closure and decreases jettisons activity (32).

Figure S3. Effect of media osmolality and trans-translation upon mscL and arfA expression.

(A) Representative E. coli growth curve at 30°C in rich media (TB) and the decline in media osmolality (ΔmOsm) caused by the cell growth (OD600). (B, C, D) Relative mscL and arfA RNA abundance (RA) measured in strains grown in TB media pre (∆mOsm = 0, OD600 ≈ 4) and post (∆mOsm∼70, OD600 ≈ 12) drop in osmolality for (B) wt, (C) wt and arfA deleted (∆arfA), and (D) wt and smpB deleted (∆smpB) E. coli K12 strains. Ct values were normalised to the RNA abundance of the most stable housekeeping genes of E. coli. (B, C, D) The error bars represent the SD of at least three biological replicates; unpaired t test analysis was performed between pre versus post osmolality drop (B) and wt versus gene-specific deleted strain (C, D) (P < 0.05*, < 0.01**, < 0.001***, < 0.0001****). ns, no significance; a.u., arbitrary units.

Figure S4. Analysis of mscL RNA and recombinant protein localisation in E. coli BL21(DE3)::mscLHis.

(A, B) Relative mscL abundance (RA) and localisation of recombinant sfGFP (B) detected in E. coli BL21(DE3) wt and::mscLHis cells grown in TB media pre (∆mOsm = 0, OD600 ≈ 4) and post (∆mOsm∼70, OD600 ≈ 12) drop in media osmolality. PP, periplasmic fraction; Ext, extracellular fraction. (C) Relative arfA abundance (RA) measured in E. coli BL21(DE3)::mscLHis cells grown in TB media post drop in osmolality (∆mOsm∼70, OD600 ≈ 12) in absence or presence of IPTG. (A, C) Unpaired t test analysis was performed in (A, C). (P < 0.05*). a.u, arbitrary units.

Figure 4. mscL regulation mediated by arfA sRNA controls MscL protein level and excretion activity.

(A) Extracellular localisation of sfGFP expressed as %ECP (RFU media/[RFU intracellular+RFU media]) (upper panel), the corresponding mscL transcript abundance (middle panel), and the MscL protein levels (lower panel) from E. coli BL21(DE3)::mscLHis wt and arfA-deleted (ΔarfA) strains expressing sfGFP, after 15 h of growth in rich media (ΔmOsm ∼ −100). MscL Western blot signal was normalised to the signal of RNAP β-polymerase (internal loading control), detected with the anti-β-pol antibody. (B) The predicted stem-loop at 3′ arfA CDS showing the two RNaseIII cut sites at nucleotide position 165 and 189. The arfA sRNAs are shown in red and green. (C) Schematic representation of the arfA variant pCAN constructs used for the rescue experiments. (C, D) mscL transcript abundance in wt and arfA-deleted (ΔarfA) strains bearing an empty pCAN plasmid or one of the constructs in panel (C), grown in minimal media (215 mOsm). (D) Analysis of recombinant protein extracellular localisation (upper panel) and mscL abundance (lower panel) in wt and arfA-deleted (ΔarfA) E. coli BL21(DE3) bearing an empty pCAN plasmid, and arfA-deleted E. coli BL21(DE3) encoding full-length arfA (pFL) or arfA sRNA (psRNA) during growth in rich media. Samples were collected after osmolality drop (∆mOsm ∼70). A representative SDS–PAGE of the media fractions is shown as inset. (A, D, E) The error bars represent the SD of three biological replicates, statistical analysis was performed by unpaired t test (A, D), and by one-way ANOVA multi-comparison test (E). (P < 0.05*, P < 0.01**, < 0.001***, < 0.0001****). ns, no significance statistic; a.u., arbitrary units.

mscL transcript is a target of arfA asRNA

The E. coli genomic arrangement of mscL and arfA genes results in an overlapping sequence between the mscL 3′ UTR and the arfA 3′ CDS (Fig 2A). Previous studies (10, 11) identified a regulatory stem-loop structure within the 3′ CDS of arfA transcript of E. coli, from the nucleotide 146 to 206 (Fig 4B). This stem-loop structure contains two sites recognised by RNaseIII that once cleaved produce a truncated transcript without a stop codon and an sRNA 54 nucleotides in length, which can be further processed into sRNAs 24 and 30 nucleotides long (10, 11). To date, the target and function of the arfA sRNA was unknown; we therefore investigated if the arfA sRNA is involved in the post-transcriptional regulation of mscL expression functioning as an antisense RNA. arfA gene variants were generated to examine the effect of arfA variation upon mscL expression. These included: arfA full-length (FL); a truncated version missing the regulatory stem-loop (arfA_Δ(154-216 nt)) (11); an inverted loop using synonymous codons to maintain correct amino acid coding but disrupt the 3′ CDS stem-loop structure (arfA_IL) (11); a mutant encoding a catalytically inactive version of ArfA (arfA_A18T) (33); and the hairpin loop (from nucleotide 160 to 203) (arfA_sRNA) (Fig 4C). For context, both arfA mutants Δ(154–216 nt) and IL are known to still produce functional ArfA proteins (10, 11). The A18T mutant carries amino acid substitution that has been shown previously to diminish ArfA protein function to rescue stalled ribosomes (33). First, we observed that arfA deletion leads to an increase in mscL transcript abundance (2.13-fold, P = 0.0004) (Fig 4D), consistent with our earlier results (Figs 2B and 3A). Next, we analysed the transcript level of mscL in ΔarfA strains. In the strains expressing arfA_FL, arfA_A18T, and arfA_sRNA, mscL transcript abundance similar to the wt strain was observed. In contrast, in the strains expressing arfA_Δ(154–216 nt) and arfA_IL mscL transcript abundance was ≅ 2.0-fold higher than wt, and similar to ΔarfA (Fig 4D). These results show that only those arfA gene variants containing the minimal complementary sequence region (nucleotide 160–203) in their 3′ CDS can rescue mscL transcript levels, and therefore that this region of arfA, and/or the sRNA derived from it, plays a direct role in the negative regulation of mscL.

To investigate if the mscL regulation mediated by the sRNA of arfA has a phenotypic role, we monitored the MscL excretion activity in an E. coli arfA–deleted strain expressing sfGFP in combination with arfA_FL or arfA_sRNA undergoing osmotic and translation stress (Fig 4E). Consistent with previous analysis (Fig 4A), arfA deletion leads to decreased excretion (twofold, P = 0.014) relative to wt (Fig 4E upper panel). Intriguingly, mscL expression levels observed in the wt strain produce the greater ECP activity, whereas the higher mscL expression observed in the ΔarfA strain leads to reduced ECP (Fig 4E). Upon expression of the arfA variants (∆arfA_pFL and ∆arfA_psRNA), the excretion phenotype activity was rescued and compared with the wt strain. Steady-state analysis of mscL transcript levels (Fig 4E lower panel) confirms that the function of arfA sRNA is to negatively regulate mscL expression at the post-transcriptional level, and in turn to increase MscL excretion activity. Implicitly, this indicates that arfA sRNA functions as an antisense RNA (asRNA) and targets the complementary 3′ UTR region of mscL mRNA.

arfA asRNA regulates mscL transcript stability

Having established that arfA asRNA mediates the negative regulation of mscL expression, we sought to investigate if it regulates mscL transcript stability. We therefore measured the stability of the native mscL transcript in the presence (wt) and absence of arfA (∆arfA). An ∼twofold increase in the mscL transcript half-life was observed in the absence of arfA (Fig 5A). These results support a hypothesis that the observed down-regulation of mscL is caused by formation of a heteroduplex between arfA sRNA and mscL mRNA which results in a decreased stability of mscL transcript. Indeed, antisense mRNA heteroduplexes are known to be cleaved by either endo- (i.e., RNaseIII and RNase E) or exoribonucleases, resulting in the destabilization of the target RNA (34).

Figure 5. Effect of arfA and RNaseIII upon mscL transcript stability and expression.

(A) Effect of arfA on the stability of mscL RNA determined by plotting the relative abundance of mscL versus time post rifampicin treatment. Total RNA was isolated from parental (wt) and arfA-deleted (ΔarfA) E. coli K12 cells. The abundance of M1 gene (RNA component of RNaseP) was used as internal standard. Half-life in minutes was determined by one phase decay non-linear fit in GraphPad Prism (version 9). (B, C) Steady-state level of mscL RNA in a nonfunctional RNaseIII genetic background (Δrnc and ΔrncΔarfA) versus wt (B), and in ΔrncΔarfA bearing either empty plasmid (pCan), expressing arfA sRNA (pCan-sRNA), or arfA FL (pCan-FL) (C). (D upper panel) Cleavage assay of in vitro transcribed mscL_FL and arfA RNAs incubated with E. coli RNaseIII. The red asterisks indicate the known sRNAs released by the cleavage of arfA and the major cleavage product released from mscL_FL. (D lower panel) Northern blot analysis of the mscL_FL cleavage reaction using 3′ UTR mscL-specific biotin labelled probe (spanning from nucleotide at position +13 to +38). IRDye streptavidin antibody was used to detect the signal, and imaging was performing using an Odyssey CLx instrument. Statistical analysis was performed by unpaired t test. The error bars represent the SD of minimal three biological replicates. (P < 0.001***). a.u., arbitrary units.

RNaseIII activity plays a role in the post-transcriptional regulation of mscL

arfA sRNAs are known to be released from the arfA transcript via RNaseIII cleavage (10, 11); we therefore next investigated whether RNaseIII affects the mscL transcript abundance via arfA sRNA. The strain missing a functional RNaseIII protein (RNaseIII(38)) (35) (Δrnc) showed a modest but significant decrease (1.5-fold, P = 0.0005) in mscL transcript level compared with the wt strain (Fig 5B). To further investigate the role of RNaseIII upon mscL expression in the absence of arfA, we sought to compare mscL transcript abundance in absence of both arfA and functional RNaseIII (ΔrncΔarfA) and of solely arfAarfA). A decrease in mscL transcript level (3.7-fold, P < 0.0001) was observed in ΔrncΔarfA strain (Fig 5B), suggesting that RNaseIII positively regulates mscL expression in an arfA independent manner. Comparison of mscL transcript abundance between both Δrnc genetic backgrounds (Δrnc and ΔrncΔarfA) show similar levels indicating that unprocessed arfA, present in Δrnc strain, is unable to down-regulate mscL expression. To validate the latter, we measured the steady-state level of mscL transcript in the ΔrncΔarfA genetic background bearing the arfA-sRNA or arfA-FL plasmid (Fig 5C). We observed a reduction in mscL transcript of about threefold (P = 0.0007) when arfA asRNA was expressed, consistent with the earlier results, confirming the role of arfA asRNA in mscL regulation (Fig 4E). In contrast, when arfA_FL was expressed, no reduction was observed, in fact, mscL abundance increased by around twofold (P = 0.0003) (Fig 5C), which could be due to the formation of a heteroduplex between mscLarfA_FL. However, arfA transcript is believed to predominately exist in the truncated form in vivo (36), so it is unclear if this heteroduplex is natively found or is an artefact driven by the high levels of arfA expression from the rescue plasmid (Fig S5). Overall, these results indicate that RNaseIII has an arfA-dependent negative effect and an arfA-independent positive effect upon mscL expression.

Figure S5. Analysis of arfA RNA.

Native and episomal arfA relative abundance (RA) measured in wt and ∆RNCarfA E. coli cells, bearing an empty and pCan-FL palsmid, respectively, grown in LB media.

mscL transcript is processed by RNaseIII in vitro

Our results suggest that RNaseIII may also regulate mscL expression in an arfA independent manner (Fig 5B); intriguingly, Kawano and co-workers identified a 49 nt small asRNA derived from the 3′ UTR of mscL (37). We therefore sought to investigate if the stem-loop within the mscL 3′ UTR (nucleotide +1 to +63) (Fig S6) is cleaved in vitro by RNaseIII similarly to arfA transcript. We synthesised two mscL transcript species, one bearing the mscL CDS and 3′ UTR stem loop (nucleotide +1 to +70) (mscL_FL) and one terminating at the stop codon (mscL_TAA). We also synthesised arfA transcript as a positive control. As previously reported, we observed that arfA transcript is processed by RNaseIII to afford two sRNAs ∼24 and ∼30 nts, which are derived from the 3′ CDS of arfA (nucleotide 166–189 and 190 to stop codon, respectively) (Fig 5D upper panel) (10, 11). In addition, we observed that mscL_FL is also a substrate of RNaseIII in vitro affording ∼25 nt sRNA as a major product which is not released from mscL_TAA transcript, following the same treatment (Fig 5D upper panel and Fig S7). Furthermore, Northern blot analysis performed with a probe complementary to mscL 3′ UTR, spanning between nucleotide +13 and +38, detected a band of ∼25 nt further confirming that the RNaseIII cleavage of mscL occurs within the 3′ UTR (Fig 5D lower panel). In summary, these results identified mscL as an RNaseIII substrate in vitro, which once cleaved releases ∼25 nt sRNA from its 3′ UTR, and therefore a truncated mscL transcript with a reduced/removed target site for the arfA asRNA.

Figure S6. The predicted secondary strucure of mscL 3′ UTR and arfA 3′ CDS.

(A) The mscL 3′ UTR stem-loop secondary structure was predicted using the RNA Vienna RNAfold web server submitting the mscL 3′ UTR sequence between the stop codon (UAA) and +70 nucleotide. (B) The arfA 3′ CDS stem-loop secondary structure was predicted using the RNA Vienna RNAfold web server submitting the arfA CDS sequence between nucleodite 144 and stop codon (UAA). The complementary region between arfA sRNA released by the cleavage of RNAseIII and mscL 3′ UTR is shown in red and green, respectively.

Figure S7. RNaseIII in vitro assay.

(A, B) RNaseIII cleavage assay with the in vitro synthesized transcripts representing the (A) full-length transcript (mscL_FL) including the 3′ UTR and (B) a truncated CDS only transcript (mscL_TAA). Cleavage reactions were incubated for 7.5, 15, 30, and 60 s at 37°C. The red dashed box highlights the ∼25 nt sRNA released from mscL_FL, but not from mscL_TAA. arfA transcript (arfA), which releases 24 and 30 nt sRNAs after cleavage by RNAseIII, was used as positive control.

Discussion

Cellular responses to hyposmotic and ribosome-stalling stress are known to be mediated by the large-conductance mechanosensitive channel (MscL) and alternative ribosome–rescue factor A (ArfA), respectively (3, 13). In addition to osmolytes, MscL has been shown to jettison cytoplasmic proteins (via ECP) (38), which is positively regulated by translational stress response mediated by ArfA (17). Intriguingly, MscL is also implicated in the cellular uptake of streptomycin (21), an aminoglycoside antibiotic that causes miscoding and ribosome stalling (4). In addition, other ribosome-targeting antibiotics have been reported to up-regulate arfA (23) and induce ECP (17). More broadly, ECP has been shown to be an important phenomenon associated with a wide variety of biological functions including biofilm formation and host–pathogen interactions (38). Here, in this study, we identified the extent of genomic conservation of mscL and arfA genes across bacteria and elucidated the mechanism by which these two genes are regulated via intergenic crosstalk and mediate ECP in response to multiple stress stimuli.

It is known that the mscL promoter is up-regulated after an increase in external osmolality and upon entry into stationary phase via RpoS (15, 31, 39). In this study, we demonstrate that mscL expression has an additional layer of genetic regulation—we discovered an arfA-dependent post-transcriptional negative regulation of mscL. Furthermore, this newly discovered post-transcriptional down-regulation of mscL operates in concert with the known transcriptional regulation of the mscL promoter in response to low osmolality. Indeed, when arfA is up-regulated, the negative regulation upon mscL is only observed post-osmotic drop (Fig S3D). arfA transcript is known to be processed by RNaseIII which releases sRNAs with a previously unknown target/regulatory function (10, 36); furthermore, RNaseIII activity has been reported to be positively regulated by hyposmotic shock (40). Here, we identified mscL transcript as the target of the arfA sRNA, which acts as an antisense RNA to down-regulate mscL by reducing the mscL transcript half-life (Fig 5A). Importantly, we show the phenotypic function of the arfA asRNA is to regulate the MscL excretory activity in response to an osmotic drop (Fig 4E).

Analysis of mscL expression under conditions of osmotic and translational stress showed a direct correlation between transcript and protein levels, but surprisingly these were inversely correlated with the excretion activity of MscL (Fig 4A). Indeed, we observed reduced ECP in the ΔarfA strain where mscL is expressed at a higher level. MscL channel gating is known to be activated after a decrease in external osmolality, and the resultant lateral force induced turgor pressure within the membrane (15, 41, 42); furthermore, it has been experimentally and computationally shown that MscL protein aggregation effects channel gating (43). Based on the computational modelling of MscL activity, Šarić and co-workers (32) proposed that ungated MscL is present in aggregate cluster-like forms in the membrane during conditions in which MscL is overexpressed, for example, under hyperosmotic condition or in stationary growth phase. This cluster formation promotes channel closure and prevents unwanted gating at low membrane tension. Upon hyposmotic shock, the cell expands and membrane tension increases, leading to separation of the channels from the cluster and individual channel gating. The proposed model shows that MscL clustering is also decreased at lower MscL concentration, and that the pore size of the gated channels depends upon the cluster size and position within it. Previously, it was also shown that MscL channel often passes through sub-states with reduced pore size before opening completely and can also revert to sub-states once opened (44, 45). Considering the results from these previous studies, it is likely that the increased mscL expression in the ΔarfA strain affects the degree of MscL clustering in the membrane, and that the reduced ECP observed is caused by higher MscL channel numbers in a clustered/ungated and/or partially opened sub-state.

Here, we propose that arfA regulates MscL excretion activity during osmotic and translational stress by post-transcriptionally decreasing mscL expression via the arfA asRNA (Fig 6), in which the arfA asRNA attenuates the number of copies of MscL per cell capable of delivering the excretory response upon both translation and osmotic stress stimuli. Analysis of mscL transcript abundance in nonfunctional RNaseIII mutant strains (Fig 5B and C) suggests the occurrence of an additional RNaseIII-dependent, but arfA-independent, regulation of mscL. Furthermore, we demonstrate that in vitro RNaseIII processing of the mscL 3′ UTR releases ∼25 nt sRNA (Fig 5D). Therefore, we speculate that the RNaseIII processed mscL transcript could escape the arfA asRNA–mediated down-regulation. Although, it is also possible that the sRNA released from mscL 3′ UTR interacts with arfA and regulates its transcript processing and/or abundance. We summarise the proposed regulation of mscL and arfA expression, their crosstalk, and impact on MscL-dependent excretion activity (Fig 6).

Figure 6. Proposed regulation of mscL and arfA expression, antisense arfA mechanism, and the impact upon MscL-dependent protein excretion of CPs.

(A) Regulation of mscL and arfA expression at the transcriptional and post-transcriptional level. mscL promoter activity is stimulated under the condition of high external osmolality (Osm), stationary phase growth, and the stress sigma factor (σS/RpoS). arfA is constitutively transcribed under the regulation of σ70/RpoD sigma factor. No evidence of cross-regulation between mscL and arfA expression at the promoter level was observed in our experiments. arfA asRNA is produced upon cleavage of arfA transcript by RNaseIII, which is more active under low osmolality (40). mscL transcript levels are post-transcriptional down-regulated by the presence of the arfA asRNA, resulting in a synergistic effect in combination with the low osmolality. However, RNaseIII processing of mscL transcript within the 3′ UTR (demonstrated here in vitro) would avoid this antisense-mediated down-regulation. arfA transcript levels are down-regulated by the trans-translation ribosome–rescue system (tmRNA), and up-regulated when tmRNA is overloaded. (B) Regulation of MscL gating and excretion activity. MscL channel gating is regulated by lateral force induced by turgor pressure within the membrane (41) and by the quaternary protein aggregation (32). During hyperosmotic stress, MscL protein levels are increased, and MscL channels are present in aggregate/ungated cluster–like forms. Under hyposmotic stress condition, MscL protein levels are decreased, and therefore MscL channels are less clustered/sub-states, and low ECP occurs. During the combination of hyposmotic and translational stress, MscL protein level is further decreased which leads to the increase of MscL channel monomers which are capable of fully gating to enable high levels of ECP. During the combination of hyposmotic and translational stress, but in the absence of ArfA (ΔarfA), intermediate numbers of MscL channels are present and moderate ECP occurs.

To investigate if the presence and genomic co-localization arrangement of mscL and arfA, as observed in E. coli, is evolutionarily conserved, we performed detailed bioinformatic gene content analysis. The data revealed that mscL is predominately present across the bacterial kingdom, consistent with previous non-exhaustive analysis (46), but arfA appears to be mostly restricted to Gammaproteobacteria. Presumably, the greater occurrence and taxonomic spread of mscL is indicative of its physiological importance across a larger array of bacteria and ecological niches relative to arfA. It also appears that arfA was likely acquired after the Proteobacteria division, as it is not present in Alphaproteobacteria and mostly absent from Betaproteobacteria, apart from a few cases that appear because of horizontal gene transfer. When considering the relevance of the presence/absence of the genes, it is important to note that both MscL and ArfA respond to stresses that have additional response mechanisms associated with them. In the case of osmotic downshock, a number of other mechanosensitive channels exist in bacteria that act as a lower gating threshold (14). In turn, ArfA is indeed one of the back-up systems for trans-translation in E. coli (33). It is possible therefore that in genomes lacking mscL and arfA that other genes/mechanisms are present to satisfy the functional requirement of the organism and its ecological niche. Therefore, the question arises as to why certain organisms require additional stress response mechanisms. From the perspective of MscL, it is clear that certain bacterial lifestyles would require greater ability to rapidly response to extreme changes in osmolarity. For ArfA, what drives the requirement for the additional ribosome rescue systems is unclear, some bacteria have additional ribosome rescue mechanisms whereas in others, for example Mycobacterium tuberculosis, only trans-translation is present and is therefore essential (47).

In genomes containing both genes, their intergenic distance also varies greatly, and clustering of these indicates enrichment for certain taxa. Genomes in which the genes are co-located (overlap and proximal, N = 128) exclusively belong to species within the order Enterobacterales. In contrast, those genomes in which the genes are distally located (N = 154) are enriched in species belonging to the order Pseudomonadales (52%). Why this variation in intergenic distance occurs is unclear. If arfA was indeed acquired subsequently to mscL, why has this occurred so differently? Or rather what is the driver for the enriched co-localisation arrangement in these Enterobacterales (observed in ∼50% of genomes). In addition, through syntenic analysis of arfA genes not co-located with mscL (arfA-only and distal clusters), we observed alternative genes that similarly displayed an unusual tail-to-tail arrangement with arfA overlapping or proximally located CDSs (Table S2). Although further functional analysis is required, based on the arfA asRNA regulation upon mscL observed here, it appears plausible that additional arfA-mediated regulation may be occurring in these alternative genetic contexts. Intriguingly, two of the most abundantly found genes co-located with arfA are both associated with iron–sulfur assembly/binding (iron–sulfur cluster assembly protein and 30S ribosomal protein S12 methylthiotransferase), indicating an association with redox sensing and stress. Based on phenotypic and mechanistic analyses demonstrated in E. coli, it seems probable that other species with a similar intergenic arrangement (overlap and proximal clusters) may also display an asRNA-mediated cross-regulation between mscL and arfA, although this remains to be experimentally validated. However, it has been previously shown that arfA transcripts from Gammaproteobacteria are cleaved by RNaseIII (36). In summary, the gene content analysis compliments the biochemical analysis and supports the findings in which this unusual co-localisation of mscL and arfA is found more broadly than just E. coli and most likely has a functional relevance among other Gammaproteobacteria.

This work raises several further important questions related to both mechanistic and physiological relevance. Does the processing of mscL 3′ UTR by RNaseIII permit the processed transcript to avoid down-regulation by arfA asRNA? Does the rescue of stalled ribosomes and the resultant nucleolytic and proteolytic degradation increase internal cellular osmolality, hyposmotic stress, and therefore RNaseIII activation? There are several reported observations that support our proposed mechanistic link between osmotic and translation stress: (i) osmotic challenge leads to cell expansion (hypo) or contraction (hyper), which affects molecular crowding (48), and in turn molecular crowding is known to be important for translation efficiency (49, 50); (ii) RNaseIII, which is known to be osmotically regulated, is responsible for processing of ribosomal RNA (51); (iii) deletion of ribosome maturation factor, RsgA, has been reported to afford salt tolerance (52); (iv) starvation of E. coli affords cross-protection to osmotic challenges (53); and (v) pre-treatment with antibiotics targeting translational machinery, impacts cell survival rates after a subsequent osmotic upshift (54) and downshift (55). Therefore, it appears plausible that impairment of the translation apparatus may affect intracellular osmolality.

A secondary set of physiological questions are: (i) what is the purpose of ECP when cells experience hyposmotic and translational stress? (ii) Does the excretion provide a defence mechanism to maintain intracellular homeostasis? (iii) Does the cell use MscL-mediated excretion following antibiotic-induced ribosome stalling to avoid proteotoxicity? In the primary trans-translation ribosome–rescue pathway, the tmRNA–SmpB complex alleviates ribosome stalling, targets nascent polypeptides for degradation (3), and promotes RNA turnover (8). In contrast, the alternative ribosome–rescue ArfA pathway displays no degradative activity (3). Therefore, it is tempting to speculate that the cell may use MscL excretion activity, regulated by arfA, to remove unwanted truncated protein and/or transcripts to prevent proteotoxicity. Finally, why does E. coli use antisense post-transcriptional control, in addition to transcriptional control, to down-regulate mscL in response to osmotic downshift? If the functional purpose of ECP is indeed to remove truncated protein and/or transcripts, the co-localization and antisense mechanism would permit an energetically efficient means of controlling MscL copy number at the post-transcriptional level, providing a rapid and transient response to osmotic downshift and translation stress. Further investigation will be required to elucidate why the osmotic and translation stress response pathways are coupled, via crosstalk between mscL and arfA, whether ECP does indeed prevent proteotoxicity following ArfA-mediated ribosome rescue, and whether the mscL–arfA regulatory mechanism is evolutionarily conserved in some or all genomic contexts.

Materials and Methods

Gene content analysis

3,822 prokaryotic proteomes were recovered from NCBI on 15/3/22. These translated CDS proteomes were recovered based on the criteria that they were first from prokaryota and second were listed as coming from either a reference or representative genome that was fully assembled to the “complete genome” level. These proteomes were filtered to remove any proteins tagged “pseudo” to remove proteins marked as problematic by the NCBI Prokaryotic Genome Annotation Process. HMMs corresponding to the ArfA protein (PF03889.16) and MscL protein (9PF01741.21) were recovered from Pfam (29) on 28/3/22 (ArfA) and 31/3/22 (MscL), respectively. HMMER (version 3.1b2) (http://hmmer.org/) was used to search for matches to the two HMMs within the collected proteomes. Hmmsearch was run using the gathering bit scores (25.5 for ArfA and 27.4 for MscL) provided by the HMMs to set model-specific score thresholds and the default values for all other settings (Supplemental Data 1). A Bonferroni corrected P-value was calculated by dividing the HMMER calculated P-value by two.

Supplemental Data 1.

[LSA-2023-01954_Supplemental_Data_1.xlsx]Full_genome_leve: The 3822 prokaryotic proteomes recovered from NCBI on 15/3/22 with full taxonomic annotation. Intergenic_analysis: Metadata and the calculated intragenic distance between mscL and arfA genes found in the same genome. arfA_synteny: Metadata and the calculated integenic distance between arfA and other co-located genes.

Intergenic distance analysis

Python (56) and several packages (NumPy (57), pandas (58), Biopython (59), and SciPy (60)) were used to calculate the distance between instances of the two genes found in the same genome. Distances were calculated from the last nucleotide of one CDS to the last nucleotide of the other CDS taking the minimum possible intergenic distance assuming genome circularity. Genomes were binned according to which genes they had (arfA only, mscL only, both genes, and neither of the genes) and then sub-binned within the “both genes” bin according to distance between the genes. Genomes in which the genes overlapped with one another were labelled “overlap,” those which were non-overlapping and closer than or at a distance of 110 nt were labelled “proximal,” and those which were also non-overlapping, but further away than 110 nt were labelled “distal.” In one case, there was a genome with one gene on a chromosome and the other on a plasmid. This genome was labelled as “distal” (Supplemental Data 1). Metadata and taxonomic information were retrieved for each of the genomes from NCBI on 12/4/22 (metadata) and 23/6/22 (taxonomic information) (Supplemental Data 1). Data were graphed using R, tidyverse (61), and Polychrome (62) packages. A cladogram of the genomes that we surveyed was produced from the NCBI taxonomy database using phyloT (https://phylot.biobyte.de). This was then visualised using iTOL (63).

Bacterial strains, plasmids, and media

E. coli strains and plasmids used in this study are listed in Table S3. To generate target gene deletions in the strain backgrounds MG1655 and BL21(DE3), lambda Red recombineering strategy was performed as described before (64), using pRL128 (65) and pSIM18 (66) plasmids. The primers used to generate FRT-flanked kanamycin selection cassettes and to construct the rescue plasmids are listed in Tables S4 and S3. For cloning purposes and general overnight starter culture, cells were grown in the LB medium (0.5% yeast extract, 0.5% NaCl, 1.0% bactotryptone). For gene expression study in minimal media, cells were grown in citrate–phosphate-defined medium, pH 7, per litre contains 8.58 g Na2HPO4, 0.87 g K2HPO4, 1.34 g citric acid, 1.0 g (NH4)2SO4, 0.001 g thiamine, 0.1 g MgSO4.7H2O, and 0.002 g (NH4)2SO4.FeSO4.6H2O, with 0.04 (starter culture) or 0.2% of glucose (experimental culture), and supplemented with 0 or 0.3 M NaCl (media osmolality of ∼215 and 764 mOsm, respectively). For gene expression studies in high cell density culture, cells were grown in TB medium (2.7% yeast extract, 4.5% glycerol, 1.3% bactotryptone, 0.2% glucose). For gene expression study in cells missing a functional RNaseIII protein (Δrnc), cells were grown in LB medium (10 g/liter NaCl, 5 g/l yeast extract, 10 g/liter tryptone).

Construction of promoter–reporter plasmids

PmscL-sfGFP and ParfA-sfGFP fragments were synthesised as gBlocks (Integrated DNA Technologies). PmscL-sfGFP contained a 321-bp fragment of the mscL promoter, including the first 11 codons of mscL (15). ParfA-sfGFP contained arfA promoter referred to the sequence from Chadani et al (11). The sfGFP CDS is located after the promoter. The DNA fragments were cloned into the low-copy p131B plasmid using NEBBuilder HiFi DNA Assembly following the manufacture’s protocol, and the resultant plasmids were used for promoter–reporter activity study.

Construction of rescue plasmids

All arfA gene variant fragments were synthesised as gBlocks (Integrated DNA Technologies) and contained upstream the T5 promoter sequence and downstream the rrnB T1, T7, and lambda T0 terminator sequences. The variant arfA_Δ(154-216 nt) contained a truncated version of full-length gene missing nucleotide 154–216 nt. The variant arfA_IL contained inverted repeats: nucleotide position at 147 (G), 156 (G), and 159 (C) were substituted with A; nucleotide position at 162 (T) was substituted with C; and nucleotide position at 171 (A) was substituted with G. The variant arfA_A18T contained the substitution of the alanine amino acid codon (AGC) in position 18 with threonine (ACC). The variant arfA_sRNA contained only the sequence from nucleotide 160 to 203. The DNA fragments were cloned into the pCA24N plasmid using NEBBuilder HiFi DNA Assembly following the manufacture’s protocol, and the resultant plasmids were used for experiments in ΔarfA-rescued strains.

Growth conditions in minimal media

Cells were first inoculated in 10 ml of citrate–phosphate medium (50 ml falcon tube) supplemented with 0.04% glucose, 50 μg/ml carbenicillin (plasmid maintenance), and when required 50 μg/ml kanamycin, then grown overnight 12–16 h at 37°C 200 rpm. The following morning, cultures were supplemented with 0.2% glucose. After one doubling, cultures were diluted 20-fold into fresh citrate–phosphate media supplemented with 0 and 0.3 M NaCl (215 and 764 mOsm, respectively), 0.2% glucose, and 50 μg/ml carbenicillin, and continued to grow at 37°C at 200 rpm (New Brunswick Scientific I26 shaker) to reach exponential growth phase (4 h) or stationary growth phase (O/N). Samples were collected at indicated time points for further analysis.

Growth conditions for high-density culture

High-density cultures were obtained by growing the cells in TB medium with an osmolality of ∼350 mOsm. After an overnight pre-inoculum in TB, cultures were diluted to OD600 0.02 in 30 ml of fresh TB medium supplemented with 0.2% glucose (UY flask), and then continued to grow at 37°C at 200 rpm (New Brunswick Scientific I26 shaker) until the desired OD600 was reached. When required, induction of recombinant protein (sfGFP) was performed by adding 250 μM IPTG at OD600 ∼1. Under these conditions, the cultures can grow to an OD600 up to ∼25 and undergo a growth-induced drop in media osmolality.

Media osmolality measurement

Cultures were centrifuged (17,000 g, 1 min or 5,000 g, 10 min) to separate media fraction from the cell pellet. The osmolality of the media fraction was measured with a cryoscopic osmometer (Osmomat 030; Gonotec) following the manufacture’s protocol.

GFP expression and ECP analysis

For promoter–reporter activity assay, GFP expressions from the intact cell were measured. Cultures were harvested (5,000g, 10 min) and washed twice in an equal volume of 1 × PBS. Relative fluorescence units (RFUs) and OD600 were measured, and GFP expressions were presented as RFU normalised to OD (RFU/OD). For ECP analysis, GFP expressions from the media and cell fractions (periplasm and spheroplast) obtained as previously described (17) were measured directly as RFU. The extracellular localisation of GFP (ECP) was expressed as %ECP (RFU in the medium/RFU intracellular + RFU media). A BMG CLARIOstar microplate reader was used to measure the colorimetric fluorescence and cell density (OD600) of intact cells.

RNA analysis by qRT-PCR

Samples for RNA analysis were collected from ∼109 cells (OD600 of 1) grown in minimal or rich media. Cellular RNA was stabilised using RNAlater (Invitrogen) following the manufacture’s protocol. RNA extraction was performed following the RNeasy mini protocol (QIAGEN). For quality control of extracted RNA, RNA integrity (RIN) was assessed using the Agilent 2100 Bioanalyser (Agilent Technologies) following the preparation protocol from RNA 6000 Nano kit (Agilent Technologies). Only RNA with a RIN > 7 (67) were used to generate the cDNA by the reverse transcriptase PCR. The RNA samples were snap-frozen in liquid nitrogen and then stored at −80°C. cDNA synthesis was performed following the SuperScript IV VILO protocol (Invitrogen), using ∼0.7 μg total extracted cellular RNA as a template. No RT enzyme control was also included to assess the presence of contaminating genomic DNA. The cDNA was stored for the short term at −20°C and long term at −80°C. The qRT-PCR reaction was performed in a volume of 10 μl in 96-well clear plates sealed with adhesive (MicroAmp Applied Biosystems) following the SYBR Green Master Mix manufacturer’s protocol (Thermo Fisher Scientific). In brief, each 10 μl reaction, including the no RT control for genomic DNA contamination, comprises 2 μl of 5× diluted cDNA, a final concentration of 1 × Syber mix (Thermo Fisher Scientific), and 300 nM forward and reverse primers (Table S5). Optimal gene–specific primers (Table S4) were designed using the Roche Online Assay Design Centre and submitted to the Basic Local Alignment Search Tool (BLAST) to check for the nonspecific binding. To compensate for error between samples (variations in cell number, RNA isolation, reverse transcription, etc), two endogenous “house-keeping” transcripts were chosen using the GeNorm algorithm (68). Initially, four reference genes used in previous analysis (recA, idnT, ffh, and cysG) (69, 70) were assayed under the experimental conditions used for this study; cysG and recA, whose expression did not change across the assayed conditions, were selected as the two most stable transcript. In the case of analysis in the nonfunctional RNaseIII strain, cysG was unstable and therefore recA was used for normalisation. Samples were amplified on a QuantStudio3 real-time PCR machine, and the temperature programme was set at 50°C for 2 min and then 95°C for 2 min followed by 40 cycles of 95°C for 15 s and 57°C for 15 s. Two to three technical and at least three biological replicates were performed for each sample. Transcript abundance of target genes expressed in a sample were normalised to the geometric mean of the two endogenous control genes. This is given by ∆Ct, where ∆Ct is determined by subtracting the geometric mean of endogenous genes Ct value from the average of target gene Ct value (Ct GOI–Ct Ref). Relative abundance (RA) was calculated by the following formula, RA = 100 × (E^-∆Ct), where E stands for amplification efficiency, as determined from the slope of the standard curve of each pair primers (E = 10(−1/slope)). Only pair primers with a % E value (= −1 + 10(−1/slope) × 100) ranging between 90% and 110% were used in this study.

RNA decay analysis

To determine the stability of the mscL transcripts, cells were grown in LB medium at 37°C at 200 rpm (New Brunswick Scientific I26 shaker) until OD600 ∼0.7, at which rifampicin (1 mg/ml) was added to block transcription. Samples were then collected 0,1,2,3, and 4 min after rifampicin addition for analysis of RNA decay by qRT-PCR as described above. The stability of mscL RNA was determined by plotting the relative amount of mscL versus the time, with the amount of mscL RNA at time 0 set to 100%. The relative mRNA abundance was calculated from Ct values of detected mscL normalised to the transcript level of the stable M1 gene (RNA component of RNaseP) (71). Half-life in minutes was determined by one-phase decay nonlinear fit in GraphPad Prism (version 9).

Western blot

Samples for protein analysis by Western blot were collected from cell cultures normalised to a volumetric OD600 of 10. Cultures were centrifuged (5,000 g, 10 min), and pellet cells were then resuspended in 400 μl of lysis buffer (PBS 1× supplemented with Roche protease inhibitor and benzonase). Cells were lysed by sonication (30% Amp, 7 s “ON” 7 s “OFF,” cold condition). Lysates were mixed with 2 × SDS–PAGE loading buffer (1:1), and then were boiled for 10 min. Equal amounts of samples were separated by SDS–PAGE and then transferred onto PVDF 0.2 μM membrane using Trans-Blot Turbo apparatus (Bio-Rad). The membrane was blocked with 5% (wt/vol) skim milk in PBS 1 × (30 min, 50 rpm, room temperature), and then probed with primary antibody (mouse monoclonal anti-His from Pierce, 1:3,000; rabbit monoclonal anti-β-Pol from Abcam, 1:2,000) overnight, 90 rpm at 4°C. After washes with 1× PBS (three times), the membrane was then incubated with secondary antibody (anti-mouse and anti-rabbit 1:30,000), 30 min, 90 rpm, at room temperature. The protein signals were detected with a LI-COR Odyssey scanner and quantified based on densitometry analysis using LI-COR Image Studio 5.0. All data were measured in biological triplicate.

In vitro transcription

DNA templates containing mscL sequence spanning from the transcription starting site to the 3′UTR (70 nts long) (mscL_FL) or to the stop codon (mscL_TAA) and arfA sequence spanning from the transcription starting size to the stop codon, both bearing the T7 promoter sequence upstream, were synthesized as gBlocks (Integrated DNA Technologies). Transcription of RNAs in vitro by T7 RNA polymerase from the DNA templates was then carried out using the MEGAscript T7 kit (Ambion) according to the manufacturer’s instructions. RNAs were then checked for quality by electrophoresis on denaturing urea gel (10% TBU, Novex).

In vitro RNaseIII cleavage assay

In vitro transcribed RNAs were subjected to RNaseIII cleavage assay as follow: 10 pmol of RNA were used in 20 μl reaction volume containing 1× enzyme buffer (AM2290; Ambion). Reactions were pre-incubated at 37°C for 5 min, followed by the addition of 0.5 U of E. coli RNaseIII (AM2290; Ambion) and further incubation at 37°C for up to 15 min. Reactions were stopped by the addition 5 mM EDTA and purified with ZipTip C18 (10 μl bed; Millipore). Cleavage products were separated on denaturing urea gel (15% TBU; Novex) which was then stained with 1× SYBRGold and exposed to a PhosphorImager screen.

Northern blot

The Northern blot was performed according the “Northern blot analysis using bitoin PCR–labelled probes” protocol from LI-COR Odyssey website with few modifications detailed below. The mscL_UTR biotin–labelled probe, containing nucleotide +13 to +38 after the mscL stop codon, was synthesized as 5′/52-Bio/modified DNA oligo (5′/52-Bio/CACTTTTTTACCACTGGTCTTCTGCT) (IDT). The transfer of RNA from denaturing urea gel onto nylon membrane was performed at 1.0 A constant for 15′ using a Trans-Blot Turbo apparatus (Bio-Rad). EDC (E7750; Sigma-Aldrich) was used to cross-link the RNA to the nylon membrane as described previously (72).

Legal Disclaimer:

EIN Presswire provides this news content "as is" without warranty of any kind. We do not accept any responsibility or liability for the accuracy, content, images, videos, licenses, completeness, legality, or reliability of the information contained in this article. If you have any complaints or copyright issues related to this article, kindly contact the author above.